- Clone
- HI100 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- IV N906
- Other Names
- GP180, L-CA, LCA, LY5, T200, PTPRC
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- TCAATCCTTCCGCTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 304175 | 10 µg | 296€ | ||||
CD45RA is a 205-220 kD single chain type I glycoprotein. It is an exon 4 splice variant of the tyrosine phosphatase CD45. The CD45RA isoform is expressed on resting/naïve T cells, medullary thymocytes, B cells and monocytes. CD45RA enhances both T cell receptor and B cell receptor signaling. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4. CD45 has also been reported to bind galectin-1. CD45 isoform expression can change in response to cytokines.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for relevant formats of this clone) include: inhibition of CD45 functions2, immunohistochemical staining of frozen tissue sections3 and formalin-fixed paraffin-embedded tissue sections4, and immunocytochemistry15,16.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
- Yamada T, et al. 2002. J. Biol. Chem. 277:28830. (WB, Block)
- Weninger W, et al. 2003 J. Immunol. 170:4638. (IHC-F)
- Imanguli MM, et al. 2009. Blood. 113:3620 (IHC-P)
- Roque S, et al. 2007. J. Immunol. 178:8028. (FC) PubMed
- Smeltz RB. 2007. J. Immunol. 178:4786. (FC) PubMed
- Palendira U, et al. 2008. Blood (FC) PubMed
- Kuttruff S, et al. 2009. Blood 113:358. (FC) PubMed
- Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
- Alanio C, et al. 2010. Blood 115:3718. (FC) PubMed
- Iannello A, et al. 2010. J. Immunol. 184:114. (FC) PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Guereau-de-Arellan M, et al. 2011. Brain. 134:3578. PubMed
- Canque B, et al. 2000. Blood 96:3748. (ICC)
- Imanguli MM, et al. 2009. Blood 13:3620. (ICC)
- Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- RRID
-
AB_2892356 (BioLegend Cat. No. 304175)
Antigen Details
- Structure
- Tyrosine phosphatases, type I transmembrane (exon 4 splicing of CD45 gene), 205-220 kD
- Distribution
-
B cells, naïve T cells, monocytes
- Function
- Enhances TCR and BCR signaling
- Ligand/Receptor
- Galectin-1, CD2, CD3, CD4
- Cell Type
- B cells, Monocytes, T cells, Tregs
- Biology Area
- Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules
- Antigen References
-
1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol.12:85. - Gene ID
- 5788 View all products for this Gene ID
- UniProt
- View information about CD45RA on UniProt.org
Related FAQs
Other Formats
View All CD45RA Reagents Request Custom ConjugationCustomers Also Purchased
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE/Dazzle™ 594 anti-human CD45RA
Human peripheral blood granulocytes were stained with CD45RA... -
APC/Fire™ 750 anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ...
-
PerCP anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RA ... -
FITC anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-A0063 anti-human CD45RA
-
Alexa Fluor® 594 anti-human CD45RA
Human paraffin-embedded tonsil tissue slices were prepared w... -
TotalSeq™-B0063 anti-human CD45RA
-
TotalSeq™-C0063 anti-human CD45RA
-
Brilliant Violet 750™ anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ... -
Spark NIR™ 685 anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ... -
APC anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
PE/Fire™ 640 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
APC anti-human CD45RA
Human peripheral blood lymphocytes stained with HI100 APC -
FITC anti-human CD45RA
Human peripheral blood lymphocytes stained with HI100 FITC -
Biotin anti-human CD45RA
Human peripheral blood lymphocytes stained with biotinylated... -
PE anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RA ...
Pre-lysed human blood leukocytes were stained with CD45RA (c...
Multiplexed IHC staining of PE anti-CD45RA (clone HI100) on ... -
PE/Cyanine5 anti-human CD45RA
Human peripheral blood lymphocytes stained with HI100 PE/Cya... -
Purified anti-human CD45RA
Human peripheral blood platelets stained with purified HI100...
SeqIF™ (sequential immunofluorescence) staining on COMET™ of... -
Pacific Blue™ anti-human CD45RA
Human peripheral blood lymphocytes stained with HI100 Pacifi... -
Alexa Fluor® 700 anti-human CD45RA
Human peripheral blood lymphocytes stained with HI100 Alexa ... -
Alexa Fluor® 488 anti-human CD45RA
Human peripheral blood lymphocytes stained with HI100 Alexa ... -
Alexa Fluor® 647 anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RA ...
Human paraffin-embedded tonsil tissue slices were prepared w... -
PerCP/Cyanine5.5 anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ...
Multiplexed IHC staining of PerCP/Cyanine5.5 anti-CD45RA (cl... -
PE/Cyanine7 anti-human CD45RA
Human peripheral blood lymphocytes were stained with HI100 P... -
Brilliant Violet 421™ anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ...
Human paraffin-embedded tonsil tissue slices were prepared w... -
Brilliant Violet 570™ anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ...
-
Brilliant Violet 605™ anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ... -
APC/Cyanine7 anti-human CD45RA
Human peripheral blood lymphocytes were stained CD45RA (clon... -
Brilliant Violet 785™ anti-human CD45RA
Human peripheral blood lymphocytes stained with CD45RA (clon... -
Brilliant Violet 510™ anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ... -
Brilliant Violet 650™ anti-human CD45RA
Human peripheral blood lymphocytes were stained with CD45RO ... -
Brilliant Violet 711™ anti-human CD45RA
Human peripheral blood lymphocytes stained with CD45RA (clon... -
Purified anti-human CD45RA (Maxpar® Ready)
Human PBMCs stained with 149Sm-anti-CD45RO (UCHL1) and 143Nd... -
PE/Fire™ 700 anti-human CD45RA Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark YG™ 581 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-D0063 anti-human CD45RA
-
Spark Violet™ 423 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu...
IHC staining of Spark Violet™ 423 anti-human CD45RA (clone H... -
PE/Cyanine7 anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
GMP FITC anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
PE/Dazzle™ 594 anti-human CD45RA
-
APC/Fire™ 750 anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
Spark UV™ 387 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP APC anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-Bn0063 anti-human CD45RA
-
Spark Blue™ 550 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PE/Dazzle™ 594 anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
GMP APC/Fire™ 750 anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
Spark PLUS UV395™ anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 810 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 810 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Blue™ 574 anti-human CD45RA (Flexi-Fluor™)
-
PerCP/Fire™ 780 anti-human CD45RA Antibody
Human peripheral blood lymphocytes were stained with anti-h... -
GMP PE/Cyanine7 anti-human CD45RA
Typical results from human peripheral blood lymphocytes stai... -
PerCP/Fire™ 806 anti-human CD45RA Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark YG™ 593 anti-human CD45RA (Flexi-Fluor™) Antibody
-
StarBright UltraViolet 795 anti-human CD45RA
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark PLUS V475™ anti-human CD45RA
Human peripheral blood cells were stained with anti-human CD...
Login / Register 



Follow Us