- Regulatory Status
- RUO
-
Major immune cell lineages and selected cell states are identified using the TotalSeq™-A Human Universal Cocktail, V2.0. Human peripheral blood mononuclear cells (PBMCs) were stained with the TotalSeq™-A Human Universal Cocktail, V2.0 and processed using the 10x Genomics Single Cell 3' v3.1 feature barcoding kit and Illumina sequencing. Protein count data were transformed and visualized in a UMAP projection overlayed with protein expression levels for each component of the cocktail. Cell clusters were identified based on protein expression only. Refer to the complete dataset to see all cocktail components profiled on PBMCs under stimulation conditions.
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 399908 | 5 tests | $6995.00 | |||
Key differentiators from the TotalSeq™-A Human Universal Cocktail, V1.0:
- This Version 2 of the cocktail contains 50 new antibodies, allowing higher dimensionality and a more detailed view of cellular heterogeneity, function, and interactions within complex biological systems.
- The selection of new antibodies was guided by high impact peer-reviewed publications and feedback from the scientific community, expanding the coverage of surface markers.
- Antibodies with strong relevance in translational research and immuno-oncology applications were carefully selected and included in this Version 2 cocktail.
- A small subset of antibodies present in Version 1 of the cocktail are not included in Version 2. These antibodies were removed due to lower prioritization based on community feedback. Antibodies that have not been included in Version 2 can be found in the clone and barcode list below.
The lyophilized cocktail provides convenience when processing several samples at the same time or at different time points, reducing inconsistencies associated with pipetting and handling multiplex vials and samples. The antibodies in the cocktail are provided at optimized concentrations to provide a ready-to-use solution once the cocktail has been reconstituted. The TotalSeq™-A Human Universal Cocktail, V2.0 comes packaged in convenient single-use vials.
Product Details
- Verified Reactivity
- Human
- Formulation
- Lyophilized from PBS containing stabilizers. Please reconstitute each tube with cell staining buffer as indicated in the Application Notes when ready to use. Make sure the cake is completely dissolved prior to using the cocktail for staining cells. The lyophilized cocktail material can vary in appearance and appear as either a lyophilized cake or a powder.
- Preparation
- This reagent is a combination of TotalSeq™-A oligo conjugated clones at optimal concentrations for single-cell sequencing analysis. See Additional Product Notes for a list of clones.
- Concentration
- Lot-specific (to obtain lot-specific concentration and expiration, please enter the lot number in our Certificate of Analysis online tool.)
- Storage & Handling
- The lyophilized antibody cocktail should be stored between 2°C and 8°C in powder form and in a sealed container with desiccant until ready to use. Once vial is opened, it is to be reconstituted immediately. After reconstitution cocktail should be used within 2 hours.
- Application
-
PG - Quality tested
- Recommended Usage
-
This panel has been optimized on human PBMCs. Using lysed whole blood or additional TotalSeq™ antibodies may require further optimization. Please contact our technical service group for further information.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Lyophilized Panel Reconstitution
IMPORTANT: Before reconstituting the lyophilized cocktail, ensure you have identified and read the associated BioLegend TotalSeq Protocol you intend to use for details regarding sample preparation, and the appropriate single-cell platform user guide. Samples should be prepared prior to or in parallel to allow for immediate staining following reconstitution of the of the cocktail. If you intend to simultaneously stain cells with hashtags or spike-in additional antibodies to the cocktail, guidance to do this can be found in our BioLegend TotalSeq Protocols and our TotalSeq™ Antibody Cocktail “Spike-in” Guidance.
Reconstitution and Staining Volume
Universal Cocktails have been optimized to stain from 2.5 x105 - 2x106 cells in a total staining volume of 50 µL (25 µL of FcR blocked cells + 25 µL of reconstituted cocktail). Details regarding sample preparation and blocking are included in BioLegend’s TotalSeq protocols. If you intend to use cell numbers outside of this range please contact BioLegend Technical Services as optimization may be required.- Remove the required number of vials from the sealed pouch and equilibrate the lyophilized cocktail vial(s) to room temperature for 5 minutes.
- Leave any unused vials in the storage pouch, reseal, and do not remove the desiccant packet. Store the resealed cocktail pouch at 4°C.
- Place lyophilized cocktail vial in an empty 1.7 mL microcentrifuge tube, spin down at 10,000 x g for 30 seconds at room temperature.
- Rehydrate lyophilized cocktail by adding 27.5 µL of Cell Staining Buffer (BioLegend Cat. No. 420201). Replace the cap and vortex for 10 seconds.
- Note: Excess volume added to aid in removal of potential protein aggregates.
- Incubate at room temperature for 5 minutes.
- Vortex again and spin down at 10,000 x g for 30 seconds at room temperature.
- Transfer the entire volume (27.5 µL) of reconstituted cocktail to a low protein binding 1.7 mL microcentrifuge tube (Fisher Cat. No. 022431081 or similar tube).
- Centrifuge at 14,000 x g for 10 min at 4°C.
- Proceed immediately to the Cell Staining section of the corresponding BioLegend protocol you are using. 25 µL of reconstituted cocktail will be used to stain 25 µL of FcR blocked cells. The final staining volume is 50 µL
If you have additional questions, please reach out to BioLegend Technical Services.
Download the complete dataset for all targets. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA[Barcode]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.
Download the excel file for a full list of clones and barcodes.
Download the Cell Ranger antibody reference and UMI counting csv file.
Antigen Details
- Gene ID
- NA