TotalSeq™-D0165 anti-human CD314 (NKG2D) Antibody

Pricing & Availability
Clone
1D11 (See other available formats)
Regulatory Status
RUO
Other Names
NKG2D
Isotype
Mouse IgG1, κ
Barcode Sequence
CGTGTTTGTTCCTCA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
320845 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD314 is a homodimeric C-type lectin-like protein also known as NKG2D. It is expressed on NK cells, CD8+ T cells, γ/δ T cells, and in vitro induced LAK cells. Several molecules have been identified as the ligands for NKG2D, including MHC class-I chain-related protein A (MICA), MICB, and UL16-binding proteins (ULBPs). NKG2D has no intrinsic signaling capacity, but attains this by non-covalent association with DAP10 or DAP12 adaptors. In addition to being a primary activation receptor on NK cells, NKG2D is also a costimulatory receptor for TCR-mediated T cell proliferation and cytokine production. The interaction of NKG2D with its ligands plays a role in the immune surveillance against pathogen and tumor cells, and in the pathogenesis of autoimmune diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 1D11 antibody blocks MICA binding to T cells, induces redirected lysis, and costimulates T cells activation and proliferation. Additional reported (for the relevant formats) applications include: immunoprecipitation1,2, blocking of ligand binding, induction of redirected cell lysis, and costimulation of T cells proliferation2-7. For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 320814) with endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Wu J, et al. 1999. Science 285:730.
  2. Wu J, et al. 2000. J. Exp. Med. 192:1059.
  3. Groh V, et al. 2001. Nature Immunol. 2:255.
  4. Wu J, et al. 2002. J. Immunol. 169:1236.
  5. Roberts A, et al. 2001. J. Immunol. 167:5527.
  6. Groh V, et al. 2003. Proc. Natl. Acad. Sci. USA 100:9452.
  7. Kraetzel K et al. 2008. Eur. Respir. J. 32:563. PubMed
  8. Correia DV, et al. 2011. Blood 118:992. (FC) PubMed
  9. Watanbe M, et al. 2014. Int Immunol. PubMed
RRID
AB_2936601 (BioLegend Cat. No. 320845)

Antigen Details

Structure
C-type lectin
Distribution

NK cells, γ/δ T cells, CD8+ T cells

Function
Cytolytic killing of target cells expressing NKG2D ligands, costimulation of NK cells and T cells
Ligand/Receptor
MICA, MICB, UL16-binding proteins (ULBPs)
Cell Type
NK cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Vance RE, et al. 1999. J. Exp. Med. 190:1801.
2. Raulet DH. 2003. Nat. Rev. Immunol. 3:781.
3. Lohwasser S, et al. 1999. Eur. J. Immunol. 29:755.
4. Jamieson AM, et al. 2002. Immunity 17:19.
5. Gilfillan S, et al. 2002. Nat. Immunol. 3:1150.
6. Ho EL, et al. 2002. J. Immunol. 169:3667.
7. Maasho K, et al. 2005. J. Immunol. 174:4480.
8. Groh V, et al. 2003. Proc. Natl. Acad. Sci. USA 100:9452.

Gene ID
22914 View all products for this Gene ID
UniProt
View information about CD314 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD314 Reagents Request Custom Conjugation
Description Clone Applications
Brilliant Violet 421™ anti-human CD314 (NKG2D) 1D11 FC
APC/Cyanine7 anti-human CD314 (NKG2D) 1D11 FC
Alexa Fluor® 647 anti-human CD314 (NKG2D) 1D11 FC
PE/Dazzle™ 594 anti-human CD314 (NKG2D) 1D11 FC
Brilliant Violet 785™ anti-human CD314 (NKG2D) 1D11 FC
Brilliant Violet 605™ anti-human CD314 (NKG2D) 1D11 FC
APC/Fire™ 750 anti-human CD314 (NKG2D) 1D11 FC
TotalSeq™-A0165 anti-human CD314 (NKG2D) 1D11 PG
TotalSeq™-C0165 anti-human CD314 (NKG2D) 1D11 PG
TotalSeq™-B0165 anti-human CD314 (NKG2D) 1D11 PG
Purified anti-human CD314 (NKG2D) 1D11 FC,IP
Biotin anti-human CD314 (NKG2D) 1D11 FC
PE anti-human CD314 (NKG2D) 1D11 FC
APC anti-human CD314 (NKG2D) 1D11 FC
PE/Cyanine7 anti-human CD314 (NKG2D) 1D11 FC
Ultra-LEAF™ Purified anti-human CD314 (NKG2D) 1D11 FC,IP,FA
Brilliant Violet 510™ anti-human CD314 (NKG2D) 1D11 FC
PerCP/Cyanine5.5 anti-human CD314 (NKG2D) 1D11 FC
FITC anti-human CD314 (NKG2D) 1D11 FC
Alexa Fluor® 660 anti-human CD314 (NKG2D) Antibody 1D11 FC
PE/Cyanine5 anti-human CD314 (NKG2D) 1D11 FC
TotalSeq™-D0165 anti-human CD314 (NKG2D) 1D11 PG
Brilliant Violet 711™ anti-human CD314 (NKG2D) 1D11 FC
Brilliant Violet 650™ anti-human CD314 (NKG2D) 1D11 FC
Spark Red™ 718 anti-human CD314 (NKG2D) (Flexi-Fluor™) 1D11 FC
Spark Blue™ 574 anti-human CD314 (NKG2D) (Flexi-Fluor™) 1D11 FC
Spark PLUS B550™ anti-human CD314 (NKG2D) Antibody 1D11 FC
Spark PLUS V475™ anti-human CD314 (NKG2D) 1D11 FC
Spark YG™ 581 anti-human CD314 (NKG2D) (Flexi-Fluor™) 1D11 FC
Spark NIR™ 685 anti-human CD314 (NKG2D) (Flexi-Fluor™) 1D11 FC
Spark YG™ 593 anti-human CD314 (NKG2D) (Flexi-Fluor™) 1D11 FC
Go To Top Version: 1    Revision Date: 02/06/2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account